Human Hepatocellular Carcinomas in China Alterations of Tumor Suppressor Genes and Allelic Losses in

Aflatoxin BI has been suggested as a causative agent for a G to T mutation at codon 249 in the p53 gene in human hepatocellular carcinomas (HCC) from southern Africa and Qidong in China. The objective of the present work was to test the hypothesis that exposure to aflatoxin B1 either alone or coincident with other environmental carcinogens might be associated with allelic losses occurring during development of human hepatocarcinogenesis in China. The HCCs were obtained from two different areas in China: Qidong, where exposure to hepatitis B virus (HBV) and aflatoxin BI is high; and Beijing, where exposure to HBV is high but that of aflatoxin BI is low. We analyzed the tumors for mutations in thep53 gene and loss of heterozygosity for the p53, Rb, and APC genes and at marker loci on chromosomes 4, 13, and 16. Frequencies of mutation, loss, and aberration (mutation and loss) of the p53 gene in 25 HCCs from Qidong were 60, 58, and 80%, respectively. The frequencies in 9 HCCs from Beijing were 56, 57, and 78%. However, the frequency of a G to T transversion at codon 249 in HCCs from Qidong and Beijing were 52 and 0%, respectively. These data indicate that mutation and/or loss of heterozygosity in the p53 gene, independent of the 249 mutation, play a critical role in the development of hepatitis B virus-associated HCCs in China. Loss of the Rb and APC genes was observed in 44 and 7% of HCCs from Qidong, respectively. Allelic losses on chromosome 4 and especially on chromosome 16 were frequent in HCCs from Qidong but were not observed in HCCs from Beijing, while loss of heterozygosity on chromosome 13 occurred at similar frequency in both Qidong and Beijing. These results show a distinct difference in the pattern of allelic losses between HCCs in Qidong and Beijing and suggest that aflatoxin B1 and/or other environmental carcinogens may contribute to this difference. I N T R O D U C ~ O N HCC 2 is one of the most common cancers in Asia and Africa (1). In general, factors associated with chronic inflammatory and regenerative changes in the liver, such as hepatitis B and C infections and alcoholic cirrhosis, are important risk factors for HCC (1-3). In addition, ingestion of aflatoxin Bl-Contaminated food is an epidemiologically defined risk factor for HCC in southern Africa and China (4--6). A synergistic interaction between aflatoxin B1 and HBV infection in the risk of HCC has also been reported (7). However, the mechanism by which aflatoxin B1 and HBV cooperate in the formation of HCC remains to a large extent unknown. Recently, a significant number of HCCs in patients from the Qidong province in China and from southern Africa, where hepatitis B virus is endemic and dietary exposure to aflatoxin B1 is high, were found to have a mutation at the third position of codon 249 of the p53 gene (6, 8-10). It has been suggested that aflatoxin B 1 is responsible for this selected mutation; however, tumors induced by aflatoxin B1 in nonhuman primates showed no mutation at codon 249 (11). Therefore, the Received 9/15/93; accepted 11/1/93. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 To whom requests for reprints should be addressed, at Laboratory of Experimental Carcinogenesis, National Cancer Institute, Building 37, Room 3C28, Bethesda, MD 20892. 2 The abbreviations used are: HCC, hepatocellular carcinoma; LOH, loss of heterozygosity; PCR-SSCP, polymerase chain reaction-single strand conformational polymorphism; HBV, hepatitis B virus; RFLP, restriction fragment length polymorphism. cooperation of aflatoxin B1 with HBV or other environmental carcinogens could also be necessary for generating the specific mutation at codon 249. LOH at specific loci occurs frequently in human tumors and is widely assumed to imply the existence of tumor suppressor genes at or near these loci. Additionally, inactivation of these genes is believed to contribute to the development of human cancer (12-14). Frequent allelic loss on specific chromosomal arms (1, 4q, 5q, l lp , 13q, 16q, and 17p) is observed in HCC (15-21). These observations suggest that loss and/or abnormal function of diverse tumor suppressor genes may be causally involved in the development of HCC. It, therefore, seems possible that the causative agent(s) for the mutation of codon 249 in the p53 gene may also contribute to loss of specific chromosomes or genes, resulting in a unique spectrum of LOH in tumors harboring the 249 mutation. To test this hypothesis, we examined LOH of the p53, Rb, and APC genes and on chromosomes 4, 13, and 16, which are frequently lost in HCCs (15-23). HCCs from Qidong, an area with high exposure of both HBV and aflatoxin B1, and Beijing, where exposure to HBV is high but aflatoxin B1 is low, were analyzed for RFLP in addition to mutational analysis of the p53 gene (24, 25) by PCR-SSCP. MATERIALS AND METHODS Preparation of DNA from Primary HCCs. HCC tissue and adjacent nontumorous tissue were obtained by surgical resection from patients in the Qidong Liver Cancer Institute located near Shanghai and the Cancer Hospital of the Chinese Academy of Medical Science in Beijing, China. These tissues were stored at -80~ Genomic DNA was prepared by the proteinase Kphenol-chloroform extraction method. PCR-SSCPAnalysis. DNA samples (0.1/~g) were subjected to the polymerase chain reaction (PCR) (26) in a mixture (5/~1) described previously (11) using two appropriate oligonucleotides as primers. Identification of the primer sequences for exons 5, 6, 7, and 8 are E5a: TTCCTCITCCTGCAGTACTC E5b: TGGATCCAGTCCCAGCTGCTCACC E6a: CACTGATTGCTCTTAGGTCT E6b: AGTTGCAAACCAGACCTCAG E7a: GGAAITCTGACTGTACCACCATCCA ETo: ACGTGGAAITCAGAGGCAAGCAGAGGCTG E8a: ACGTGAATTCCITACTGCCTCCTGCIT E8b: ACGTGGAATI'CGTGGCAAGGCTCCCCTIT The 5'-ends of these primers were labeled by the polynucleotide kinase reaction with [-/-32p]ATP as described previously (11). The amplified and labeled DNA fragments were subjected to electrophoresis at 40 W for 1-4 h in a 6% nondenaturing polyacrylamide gel with 10% glycerol in a cold room (27, 28). DNA Sequencing. DNA fragments which showed mobility shifts by SSCP analysis were eluted from the gel and amplified by PCR using the same primers, but phosphorylated with T4 polynucleotidekinase and ATE The PCR products were purified with phenol-chloroform, blunt-ended with T4 DNA polymerase and deoxynucleotide triphosphates, and separated in a 3% agarose gel. The purified PCR products were ligated into Sinai-cut dephosphorylated pGEM7 (Promega, Madison, WI) vector (29). Alternatively, PCR products were directly subcloned using the TA Cloning kit (Invitrogen Corp., San Diego, CA). For each sample which showed a mobility shift, two individual clones were sequenced by the dideoxy chain termination method of Sanger et al. (30). 281 American Association for Cancer Research Copyright © 1994 on February 23, 2013 cancerres.aacrjournals.org Downloaded from p53 GENE ABERRATION AND ALLELIC LOSS IN HEPATOCELLULAR CARCINOMA A l l m u t a t i o n s w e r e c o n f i r m e d by a c o m p l e t e r epea t o f the e x p e r i m e n t a l p roc e d u r e ; P C R S S C P o f g e n o m i c D N A s , D N A f r a g m e n t e x t r a c t i o n f r o m the ge l , P C R , c lon ing , and s e q u e n c i n g . R F L P A n a l y s i s b y P C R . F o u r se ts o f P C R p r i m e r s w e r e u s e d to de tec t the p o l y m o r p h i c res t r i c t ion e n d o n u c l e a s e s i tes w i t h i n the APC, Rb, and p5B genes . I d e n t i f i c a t i o n o f the o l i g o n u c l e o t i d e s e q u e n c e s used as p r i m e r s fo r the A P C g e n e e x o n 11 (31) , the Rb g e n e in t ron 25 (32), and the p53 g e n e e x o n 4 (33) and in t ron 6 (34) a re A P C e l l a : G A T G A T r G T C I T I T I ' C C T C T A P C e l l b : C T G A G C T A T C T r A A G A A A T A R b i 2 5 a : A T C G A A A G C A T C A T A G T r A C R b i 2 5 b : T A A C G A A A A G A C T r C I T G C A P 5 3 e 4 a : A T C T A C A G T C C C C C T r G C C G P 5 3 e 4 b : G C A A C T G A C C G T G C A A G T C A P53 i6a : A G G T C T G G T I T G C A A C I ' G G G P53 i6b : G A G G T C A A A T A A G C A G C A G G P C R a m p l i f i c a t i o n s w e r e p e r f o r m e d u s i n g a G e n e A m p ki t (Pe rk in E l m e r Ce tus , N o r w a l k , C T ) c o n s i s t i n g o f 40 c y c l e s o f 9 5 ~ (1 min ) , 5 5 ~ (1 min ) , and 7 0 ~ (2 min ) . T h e P C R p r o d u c t fo r e a c h o f the f o u r p o l y m o r p h i c res t r ic t ion e n d o n u c l e a s e s i tes w a s d i g e s t e d w i t h RsaI, DraI, BstUI, or MspI, r e spec t ive ly . T h e f r a g m e n t s w e r e f r a c t i o n a t e d by 3 % a g a r o s e ge l e l e c t r o p h o r e s i s . R F L P A n a l y s i s b y S o u t h e r n B l o t . Ten /xg o f e a c h D N A s a m p l e w e r e c o m p l e t e l y d i g e s t e d w i t h an a p p r o p r i a t e r e s t r i c t ion e n d o n u c l e a s e , e l e c t r o p h o r e sed on 0.8 or 1 .0% a g a r o s e ge ls , and t r ans fe r red to n y l o n f i l te rs by S o u t h e r n b lo t t ing . T h e f i l t e r s w e r e h y b r i d i z e d w i t h 3Zplabeled p r o b e s that w e r e p re p a r e d w i t h a m u l t i p r i m e D N A l a b e l i n g s y s t e m ( A m e r s h a m Corp . , A r l i n g t o n , IL) , w a s h e d u n d e r s t r i ngen t c o n d i t i o n s , and e x p o s e d fo r a u t o r a d i o g r a p h y . T h e p o l y m o r p h i c marker , M T 2 P 1 w a s used for c h r o m o s o m e 4, D13S1 w a s u s e d fo r c h r o m o s o m e 13, and f o u r p o l y m o r p h i c marke r s , D16S83, D16S34, TATBBO.4, and D16S7, w e r e used fo r c h r o m o s o m e 16. T h e res t r i c t ion e n d o n u c l e a s e s u s e d for the m a r k e r s w e r e EcoRI, MspI, RsaI, PstI, BamHI, and TaqI, r e spec t ive ly . T w o p o l y m o r p h i c res t r i c t ion e n d o n u c l e a s e si tes, BgllI and BanlI, w e r e used to de tec t L O H o f the p53 gene . Integration of HBV D N A . E a c h D N A s a m p l e w a s d i g e s t e d w i t h HindlII, t r ans fe r r ed o n t o a m e m b r a n e , and p r o b e d fo r hepa t i t i s B v i ru s ( sub type a y w ) to c h e c k fo r i n t eg ra t i on o f the v i ru s in to the hos t g e n o m e (35).